Review



mouse transferrin / serotransferrin protein  (Sino Biological)


Bioz Verified Symbol Sino Biological is a verified supplier
Bioz Manufacturer Symbol Sino Biological manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Sino Biological mouse transferrin / serotransferrin protein
    Mouse Transferrin / Serotransferrin Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m02h/Mouse+Transferrin+%2F+Serotransferrin+Protein/custom%4050817-m02h%4042093838
    Average 99 stars, based on 1 article reviews
    mouse transferrin / serotransferrin protein - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Th1/17 polarization and potential treatment by an anti-interferon-γ DNA aptamer in Hunner-type interstitial cystitis
    Article Snippet: .. Recombinant mouse IFN-γ proteins , Sino Biological , #50709-M02H, #50709-MNAH. ..

    Article Title: AF6 regulates intestinal IgA via crosstalk between intestinal epithelial cells and immune cells in inflammatory bowel disease
    Article Snippet: Recombinant Human R-spondin1/RSPO1 protein , Sino Biological , Cat#11083-HNAS. .. Recombinant Mouse Noggin/NOG protein (hFc Tag) , Sino Biological , Cat50688-M02H. .. Recombinant Mouse EGF protein , Sino Biological , Cat#50482-MNCH.

    Article Title: Therapeutic avenues in bone repair: Harnessing an anabolic osteopeptide, PEPITEM, to boost bone growth and prevent bone loss
    Article Snippet: Zoledronic acid hydrate , Cambridge Biosciences , Cat: CAY14984. .. Recombinant Mouse FGFR1 , Sino Biological , Cat: 50186-M02H. ..

    Article Title: Identification of a binding site on soluble RANKL that can be targeted to inhibit soluble RANK-RANKL interactions and treat osteoporosis
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-Phospho-NF-κB p65 (Ser536) antibody Cell Signaling Technology Cat# 3033; RRID: AB_331284 Rabbit monoclonal anti-NF-κB p65 NF-κB p65 antibody Cell Signaling Technology Cat# 8242; RRID: AB_10859369 Rabbit monoclonal anti-Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) antibody Cell Signaling Technology Cat# 4370; RRID: AB_2315112 Rabbit monoclonal anti-p44/42 MAPK (Erk1/2) antibody Cell Signaling Technology Cat# 4695; RRID: AB_390779 Rabbit monoclonal anti-Phospho-IκBα (Ser32) (14D4) antibody Cell Signaling Technology Cat# 2859; RRID: AB_561111 Rabbit monoclonal anti- IκBα antibody Cell Signaling Technology Cat# 4812; RRID: AB_10694416 Rabbit monoclonal anti-Phospho-SAPK/JNK antibody (Thr183/Tyr185) (81E11) antibody Cell Signaling Technology Cat# 4668; RRID: AB_823588 Rabbit monoclonal anti-SAPK/JNK antibody Cell Signaling Technology Cat# 9252; RRID: AB_2250373 Rabbit monoclonal anti-Phospho-Akt (Ser473) antibody Cell Signaling Technology Cat# 9271; RRID: AB_329825 Rabbit monoclonal-anti-pan-AKT antibody Abcam Cat# ab8805; RRID: AB_306791 Rabbit monoclonal anti-PI 3 Kinase p85 alpha (phospho Y607) antibody Abcam Cat# ab182651; RRID: AB_2756407 Rabbit monoclonal anti-PI 3 Kinase p85 alpha antibody Abcam Cat# ab191606 Rabbit monoclonal anti-beta actin antibody Abcam Cat# ab8226; RRID: AB_306371 Bacterial Escherichia coli DH5 alpha cells This study N/A Escherichia coli BL21 (DE3) cells This study N/A Chemicals and Recombinant Proteins Fetal Bovine Serum (Mammalian cell culture) Bovogen Cat# 1803A Penicillin-Streptomycin (Mammalian Cell Culture) Gibco Cat# 15140122 MEM-alpha basic (Medium for mammalian cell culture) Gibco Cat# C12641800BT DMEM (Medium for mammalian cell culture) Gibco Cat# C11965500BT Murine M-CSF Peprotech Cat# 315-02 In Vivo Ready anti-Human CD28 (CD28.2) Tonbo Biosciences Cat# 40-0289-U500 In Vivo Ready anti-Human CD3 (OKT3) Tonbo Biosciences Cat# 40-0037-U500 Human IL-2 Peprotech Cat# 200-02 GST-RANKL This study N/A RANKL This study N/A L-RANKL This study N/A RANK This study N/A Biotin Energy chemical Cat# E080117; CAS: 58-85-5 Human osteoprotegerin, Fc tag Acrobiosytems Cat# TNB-H5259-100 μg Mouse osteoprotegerin, Fc tag SinoBiological Cat# 52613-M02H .. Critical Commercial Assays Acid Phosphatase, Leukocyte (TRAP) Kit Sigma Cat# 387A RevertAidTM First Strand cDNA Synthesis Kit Thermo Fisher Cat# K1622 Maxima SYBR Green/Fluorescein qPCR Master Mix (2X) Thermo Fisher Cat# K0241 Annexin V-FITC Apoptosis Detection Kit Bevotime Cat# C1062L T4 ligase Merck 69839 PCR reaction Kit TOYOBO QPK-201 Plasmid Midiprep Kit QIAGEN 12145 PE-Cyanine7 anti-Human CD8a (RPA-T8) Tonbo Biosciences Cat# 60-0088-T100 PE anti-Human CD4 (RPA-T4) Tonbo Biosciences Cat# 50-0049-T100 PerCP-Cyanine5.5 anti-Human CD3 (OKT3) Tonbo Biosciences Cat# 65-0037-T100 ELISA Kit for Human Osteoprotegerin Wuhan USCN Business Cat# SEA108Hu ELISA Kit for Mouse Osteoprotegerin Wuhan USCN Business Cat# SEA108Mu REAGENT or RESOURCE Ni-NTA agarose resin QIAGEN 30210 Glutathione Agarose Resin Merck G4510 Streptavidin−Agarose from Streptomyces avidinii Sigma Cat# S1638 Carboxyfluorescein succinimidyl amino ester (CFSE) Tonbo Biosciences Cat# 13-0850-U500 Chemical characterizations This study N/A Experimental Models: Cell Lines Mouse: RAW264.7 cells ATCC Cat# TIB-71, RRID: CVCL_0493 Mouse: RAW264.7 cells stably transfected with an NF-κB-driven luciferase reporter gene construct (3kB-Luc-SV40) JiaKe Xu Lab N/A Mouse: RAW264.7 cells stably transfected with an NFATc1 luciferase reporter construct JiaKe Xu Lab N/A Human: HEK293T ATCC Cat# CRL-3216, RRID: CVCL_0063 BMMs This study N/A Experimental Models: Organisms/Strains C57BL/6 (Female) Guangdong Medical Laboratory Animal Center N/A Sprague Dawley rat (SD, Female) Guangdong Medical Laboratory Animal Center N/A Oligonucleotides DC-stamp F:5‘-GGGGACTTATGTGTTTCCACG-3‘ Sangon Biotech N/A DC-stamp R:5‘-ACAAAGCAACAGACTCCCAAAT-3‘ Sangon Biotech N/A Calcr F: 5‘-TGCAGACAACTCTTGGTTGG-3‘ Sangon Biotech N/A Calcr R:5‘-TCGGTTTCTTCTCCTCTGGA-3‘ Sangon Biotech N/A Oscar F: 5‘-CTCTTCAAAAGTGGCCTTGTCA-3‘ Sangon Biotech N/A Oscar R: 5‘-GGAAGAACTCAGCCAGCTCAA-3‘ Sangon Biotech N/A Tracp F: 5‘-GGCTATGTGCTGAG-3‘ Sangon Biotech N/A Tracp R: 5‘- GGAGGCTGGTCTTA-3‘ Sangon Biotech N/A β-actin F: TCCAGCCTTCCTTCTTGGGTAT Sangon Biotech N/A β-actin R: TGTTGGCATAGAGGTCTTTACGG Sangon Biotech N/A Ctsk F: CAGCAGAACGGAGGCATTGA Sangon Biotech N/A Ctsk R:CCTTTGCCGTGGCGTTATAC Sangon Biotech N/A MMP9 F: CCTACTCTGCCTGCACCACTAAA Sangon Biotech N/A MMP9 R: CTGCTTGCCCAGGAAGACGAA Sangon Biotech N/A Software and Algorithms MOE 2018 Chemical Computing Group ULC N/A Pymol 2.3.4 Schrödinger N/A ChemBioOffice 2014 CambridgeSoft N/A Schrödinger 2018-1 Schrödinger N/A Amber 16 AMBER Software Administrator N/A GraphPad Prism 8 GraphPad Software N/A ImageJ NIH N/A ProteOn XPR36 ProteonManager Bio-Rad N/Ac The sequences of sRANKL and mRANKL mimics The amino acid sequence of sRANKL was the C-terminal extracellular region of RANKL (rat 159-318 aa).

    other:

    Article Title: Combinatorial leaky probiotic for anticancer immunopotentiation and tumor eradication
    Article Snippet: PD-L1 , Sino Biological , Cat: 50010-M02H.

    Article Title: Robust transcriptomic hallmarks targeting intratumor heterogeneity in intrahepatic cholangiocarcinoma
    Article Snippet: Noggin , Sino Biological , Cat 50688-M02H.

    Article Title: Combinatorial leaky probiotic for anticancer immunopotentiation and tumor eradication
    Article Snippet: CTLA4 , Sino Biological , Cat: 50503-M02H.

    Article Title: Comprehensive dissection of rectal cancer organoids in responses to chemoradiation
    Article Snippet: Noggin , Sino Biological , Cat# 50688-M02H.

    Cell Culture:

    Article Title: Identification of a binding site on soluble RANKL that can be targeted to inhibit soluble RANK-RANKL interactions and treat osteoporosis
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-Phospho-NF-κB p65 (Ser536) antibody Cell Signaling Technology Cat# 3033; RRID: AB_331284 Rabbit monoclonal anti-NF-κB p65 NF-κB p65 antibody Cell Signaling Technology Cat# 8242; RRID: AB_10859369 Rabbit monoclonal anti-Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) antibody Cell Signaling Technology Cat# 4370; RRID: AB_2315112 Rabbit monoclonal anti-p44/42 MAPK (Erk1/2) antibody Cell Signaling Technology Cat# 4695; RRID: AB_390779 Rabbit monoclonal anti-Phospho-IκBα (Ser32) (14D4) antibody Cell Signaling Technology Cat# 2859; RRID: AB_561111 Rabbit monoclonal anti- IκBα antibody Cell Signaling Technology Cat# 4812; RRID: AB_10694416 Rabbit monoclonal anti-Phospho-SAPK/JNK antibody (Thr183/Tyr185) (81E11) antibody Cell Signaling Technology Cat# 4668; RRID: AB_823588 Rabbit monoclonal anti-SAPK/JNK antibody Cell Signaling Technology Cat# 9252; RRID: AB_2250373 Rabbit monoclonal anti-Phospho-Akt (Ser473) antibody Cell Signaling Technology Cat# 9271; RRID: AB_329825 Rabbit monoclonal-anti-pan-AKT antibody Abcam Cat# ab8805; RRID: AB_306791 Rabbit monoclonal anti-PI 3 Kinase p85 alpha (phospho Y607) antibody Abcam Cat# ab182651; RRID: AB_2756407 Rabbit monoclonal anti-PI 3 Kinase p85 alpha antibody Abcam Cat# ab191606 Rabbit monoclonal anti-beta actin antibody Abcam Cat# ab8226; RRID: AB_306371 Bacterial Escherichia coli DH5 alpha cells This study N/A Escherichia coli BL21 (DE3) cells This study N/A Chemicals and Recombinant Proteins Fetal Bovine Serum (Mammalian cell culture) Bovogen Cat# 1803A Penicillin-Streptomycin (Mammalian Cell Culture) Gibco Cat# 15140122 MEM-alpha basic (Medium for mammalian cell culture) Gibco Cat# C12641800BT DMEM (Medium for mammalian cell culture) Gibco Cat# C11965500BT Murine M-CSF Peprotech Cat# 315-02 In Vivo Ready anti-Human CD28 (CD28.2) Tonbo Biosciences Cat# 40-0289-U500 In Vivo Ready anti-Human CD3 (OKT3) Tonbo Biosciences Cat# 40-0037-U500 Human IL-2 Peprotech Cat# 200-02 GST-RANKL This study N/A RANKL This study N/A L-RANKL This study N/A RANK This study N/A Biotin Energy chemical Cat# E080117; CAS: 58-85-5 Human osteoprotegerin, Fc tag Acrobiosytems Cat# TNB-H5259-100 μg Mouse osteoprotegerin, Fc tag SinoBiological Cat# 52613-M02H .. Critical Commercial Assays Acid Phosphatase, Leukocyte (TRAP) Kit Sigma Cat# 387A RevertAidTM First Strand cDNA Synthesis Kit Thermo Fisher Cat# K1622 Maxima SYBR Green/Fluorescein qPCR Master Mix (2X) Thermo Fisher Cat# K0241 Annexin V-FITC Apoptosis Detection Kit Bevotime Cat# C1062L T4 ligase Merck 69839 PCR reaction Kit TOYOBO QPK-201 Plasmid Midiprep Kit QIAGEN 12145 PE-Cyanine7 anti-Human CD8a (RPA-T8) Tonbo Biosciences Cat# 60-0088-T100 PE anti-Human CD4 (RPA-T4) Tonbo Biosciences Cat# 50-0049-T100 PerCP-Cyanine5.5 anti-Human CD3 (OKT3) Tonbo Biosciences Cat# 65-0037-T100 ELISA Kit for Human Osteoprotegerin Wuhan USCN Business Cat# SEA108Hu ELISA Kit for Mouse Osteoprotegerin Wuhan USCN Business Cat# SEA108Mu REAGENT or RESOURCE Ni-NTA agarose resin QIAGEN 30210 Glutathione Agarose Resin Merck G4510 Streptavidin−Agarose from Streptomyces avidinii Sigma Cat# S1638 Carboxyfluorescein succinimidyl amino ester (CFSE) Tonbo Biosciences Cat# 13-0850-U500 Chemical characterizations This study N/A Experimental Models: Cell Lines Mouse: RAW264.7 cells ATCC Cat# TIB-71, RRID: CVCL_0493 Mouse: RAW264.7 cells stably transfected with an NF-κB-driven luciferase reporter gene construct (3kB-Luc-SV40) JiaKe Xu Lab N/A Mouse: RAW264.7 cells stably transfected with an NFATc1 luciferase reporter construct JiaKe Xu Lab N/A Human: HEK293T ATCC Cat# CRL-3216, RRID: CVCL_0063 BMMs This study N/A Experimental Models: Organisms/Strains C57BL/6 (Female) Guangdong Medical Laboratory Animal Center N/A Sprague Dawley rat (SD, Female) Guangdong Medical Laboratory Animal Center N/A Oligonucleotides DC-stamp F:5‘-GGGGACTTATGTGTTTCCACG-3‘ Sangon Biotech N/A DC-stamp R:5‘-ACAAAGCAACAGACTCCCAAAT-3‘ Sangon Biotech N/A Calcr F: 5‘-TGCAGACAACTCTTGGTTGG-3‘ Sangon Biotech N/A Calcr R:5‘-TCGGTTTCTTCTCCTCTGGA-3‘ Sangon Biotech N/A Oscar F: 5‘-CTCTTCAAAAGTGGCCTTGTCA-3‘ Sangon Biotech N/A Oscar R: 5‘-GGAAGAACTCAGCCAGCTCAA-3‘ Sangon Biotech N/A Tracp F: 5‘-GGCTATGTGCTGAG-3‘ Sangon Biotech N/A Tracp R: 5‘- GGAGGCTGGTCTTA-3‘ Sangon Biotech N/A β-actin F: TCCAGCCTTCCTTCTTGGGTAT Sangon Biotech N/A β-actin R: TGTTGGCATAGAGGTCTTTACGG Sangon Biotech N/A Ctsk F: CAGCAGAACGGAGGCATTGA Sangon Biotech N/A Ctsk R:CCTTTGCCGTGGCGTTATAC Sangon Biotech N/A MMP9 F: CCTACTCTGCCTGCACCACTAAA Sangon Biotech N/A MMP9 R: CTGCTTGCCCAGGAAGACGAA Sangon Biotech N/A Software and Algorithms MOE 2018 Chemical Computing Group ULC N/A Pymol 2.3.4 Schrödinger N/A ChemBioOffice 2014 CambridgeSoft N/A Schrödinger 2018-1 Schrödinger N/A Amber 16 AMBER Software Administrator N/A GraphPad Prism 8 GraphPad Software N/A ImageJ NIH N/A ProteOn XPR36 ProteonManager Bio-Rad N/Ac The sequences of sRANKL and mRANKL mimics The amino acid sequence of sRANKL was the C-terminal extracellular region of RANKL (rat 159-318 aa).

    In Vivo:

    Article Title: Identification of a binding site on soluble RANKL that can be targeted to inhibit soluble RANK-RANKL interactions and treat osteoporosis
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-Phospho-NF-κB p65 (Ser536) antibody Cell Signaling Technology Cat# 3033; RRID: AB_331284 Rabbit monoclonal anti-NF-κB p65 NF-κB p65 antibody Cell Signaling Technology Cat# 8242; RRID: AB_10859369 Rabbit monoclonal anti-Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) antibody Cell Signaling Technology Cat# 4370; RRID: AB_2315112 Rabbit monoclonal anti-p44/42 MAPK (Erk1/2) antibody Cell Signaling Technology Cat# 4695; RRID: AB_390779 Rabbit monoclonal anti-Phospho-IκBα (Ser32) (14D4) antibody Cell Signaling Technology Cat# 2859; RRID: AB_561111 Rabbit monoclonal anti- IκBα antibody Cell Signaling Technology Cat# 4812; RRID: AB_10694416 Rabbit monoclonal anti-Phospho-SAPK/JNK antibody (Thr183/Tyr185) (81E11) antibody Cell Signaling Technology Cat# 4668; RRID: AB_823588 Rabbit monoclonal anti-SAPK/JNK antibody Cell Signaling Technology Cat# 9252; RRID: AB_2250373 Rabbit monoclonal anti-Phospho-Akt (Ser473) antibody Cell Signaling Technology Cat# 9271; RRID: AB_329825 Rabbit monoclonal-anti-pan-AKT antibody Abcam Cat# ab8805; RRID: AB_306791 Rabbit monoclonal anti-PI 3 Kinase p85 alpha (phospho Y607) antibody Abcam Cat# ab182651; RRID: AB_2756407 Rabbit monoclonal anti-PI 3 Kinase p85 alpha antibody Abcam Cat# ab191606 Rabbit monoclonal anti-beta actin antibody Abcam Cat# ab8226; RRID: AB_306371 Bacterial Escherichia coli DH5 alpha cells This study N/A Escherichia coli BL21 (DE3) cells This study N/A Chemicals and Recombinant Proteins Fetal Bovine Serum (Mammalian cell culture) Bovogen Cat# 1803A Penicillin-Streptomycin (Mammalian Cell Culture) Gibco Cat# 15140122 MEM-alpha basic (Medium for mammalian cell culture) Gibco Cat# C12641800BT DMEM (Medium for mammalian cell culture) Gibco Cat# C11965500BT Murine M-CSF Peprotech Cat# 315-02 In Vivo Ready anti-Human CD28 (CD28.2) Tonbo Biosciences Cat# 40-0289-U500 In Vivo Ready anti-Human CD3 (OKT3) Tonbo Biosciences Cat# 40-0037-U500 Human IL-2 Peprotech Cat# 200-02 GST-RANKL This study N/A RANKL This study N/A L-RANKL This study N/A RANK This study N/A Biotin Energy chemical Cat# E080117; CAS: 58-85-5 Human osteoprotegerin, Fc tag Acrobiosytems Cat# TNB-H5259-100 μg Mouse osteoprotegerin, Fc tag SinoBiological Cat# 52613-M02H .. Critical Commercial Assays Acid Phosphatase, Leukocyte (TRAP) Kit Sigma Cat# 387A RevertAidTM First Strand cDNA Synthesis Kit Thermo Fisher Cat# K1622 Maxima SYBR Green/Fluorescein qPCR Master Mix (2X) Thermo Fisher Cat# K0241 Annexin V-FITC Apoptosis Detection Kit Bevotime Cat# C1062L T4 ligase Merck 69839 PCR reaction Kit TOYOBO QPK-201 Plasmid Midiprep Kit QIAGEN 12145 PE-Cyanine7 anti-Human CD8a (RPA-T8) Tonbo Biosciences Cat# 60-0088-T100 PE anti-Human CD4 (RPA-T4) Tonbo Biosciences Cat# 50-0049-T100 PerCP-Cyanine5.5 anti-Human CD3 (OKT3) Tonbo Biosciences Cat# 65-0037-T100 ELISA Kit for Human Osteoprotegerin Wuhan USCN Business Cat# SEA108Hu ELISA Kit for Mouse Osteoprotegerin Wuhan USCN Business Cat# SEA108Mu REAGENT or RESOURCE Ni-NTA agarose resin QIAGEN 30210 Glutathione Agarose Resin Merck G4510 Streptavidin−Agarose from Streptomyces avidinii Sigma Cat# S1638 Carboxyfluorescein succinimidyl amino ester (CFSE) Tonbo Biosciences Cat# 13-0850-U500 Chemical characterizations This study N/A Experimental Models: Cell Lines Mouse: RAW264.7 cells ATCC Cat# TIB-71, RRID: CVCL_0493 Mouse: RAW264.7 cells stably transfected with an NF-κB-driven luciferase reporter gene construct (3kB-Luc-SV40) JiaKe Xu Lab N/A Mouse: RAW264.7 cells stably transfected with an NFATc1 luciferase reporter construct JiaKe Xu Lab N/A Human: HEK293T ATCC Cat# CRL-3216, RRID: CVCL_0063 BMMs This study N/A Experimental Models: Organisms/Strains C57BL/6 (Female) Guangdong Medical Laboratory Animal Center N/A Sprague Dawley rat (SD, Female) Guangdong Medical Laboratory Animal Center N/A Oligonucleotides DC-stamp F:5‘-GGGGACTTATGTGTTTCCACG-3‘ Sangon Biotech N/A DC-stamp R:5‘-ACAAAGCAACAGACTCCCAAAT-3‘ Sangon Biotech N/A Calcr F: 5‘-TGCAGACAACTCTTGGTTGG-3‘ Sangon Biotech N/A Calcr R:5‘-TCGGTTTCTTCTCCTCTGGA-3‘ Sangon Biotech N/A Oscar F: 5‘-CTCTTCAAAAGTGGCCTTGTCA-3‘ Sangon Biotech N/A Oscar R: 5‘-GGAAGAACTCAGCCAGCTCAA-3‘ Sangon Biotech N/A Tracp F: 5‘-GGCTATGTGCTGAG-3‘ Sangon Biotech N/A Tracp R: 5‘- GGAGGCTGGTCTTA-3‘ Sangon Biotech N/A β-actin F: TCCAGCCTTCCTTCTTGGGTAT Sangon Biotech N/A β-actin R: TGTTGGCATAGAGGTCTTTACGG Sangon Biotech N/A Ctsk F: CAGCAGAACGGAGGCATTGA Sangon Biotech N/A Ctsk R:CCTTTGCCGTGGCGTTATAC Sangon Biotech N/A MMP9 F: CCTACTCTGCCTGCACCACTAAA Sangon Biotech N/A MMP9 R: CTGCTTGCCCAGGAAGACGAA Sangon Biotech N/A Software and Algorithms MOE 2018 Chemical Computing Group ULC N/A Pymol 2.3.4 Schrödinger N/A ChemBioOffice 2014 CambridgeSoft N/A Schrödinger 2018-1 Schrödinger N/A Amber 16 AMBER Software Administrator N/A GraphPad Prism 8 GraphPad Software N/A ImageJ NIH N/A ProteOn XPR36 ProteonManager Bio-Rad N/Ac The sequences of sRANKL and mRANKL mimics The amino acid sequence of sRANKL was the C-terminal extracellular region of RANKL (rat 159-318 aa).



    Similar Products

    94
    sino biological 50688-m02h
    50688 M02h, supplied by sino biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m02h/Mouse+Noggin+%2F+NOG+Protein/pmc13130669-74-0-2
    Average 94 stars, based on 1 article reviews
    50688-m02h - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    99
    Sino Biological mouse transferrin / serotransferrin protein
    Mouse Transferrin / Serotransferrin Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m02h/Mouse+Transferrin+%2F+Serotransferrin+Protein/custom%4050817-m02h%4042093838
    Average 99 stars, based on 1 article reviews
    mouse transferrin / serotransferrin protein - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    94
    Sino Biological mouse pd-l1 / b7-h1 / cd274 protein
    Mouse Pd L1 / B7 H1 / Cd274 Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m02h/Mouse+PD-L1+%2F+B7-H1+%2F+CD274+Protein/custom%4050010-m02h%4042597831
    Average 94 stars, based on 1 article reviews
    mouse pd-l1 / b7-h1 / cd274 protein - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Sino Biological mouse egfr / her1 / erbb1 protein
    Mouse Egfr / Her1 / Erbb1 Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m02h/Mouse+EGFR+%2F+HER1+%2F+ErbB1+Protein/custom%4051091-m02h%4010%2E64898%2F2026%2E06%2E22%2E732379
    Average 94 stars, based on 1 article reviews
    mouse egfr / her1 / erbb1 protein - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    93
    Sino Biological mouse pd1 / pdcd1 / cd279 protein
    Mouse Pd1 / Pdcd1 / Cd279 Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m02h/Mouse+PD1+%2F+PDCD1+%2F+CD279+Protein/custom%4050124-m02h%4042306793
    Average 93 stars, based on 1 article reviews
    mouse pd1 / pdcd1 / cd279 protein - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    94
    Sino Biological human egfr / her1 / erbb1 (aa 668-1210) protein
    Human Egfr / Her1 / Erbb1 (Aa 668 1210) Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m02h/Human+EGFR+%2F+HER1+%2F+ErbB1+(aa+668-1210)+Protein/custom%4010001-h20b2%4010%2E1016%2Fj%2Ecej%2E2026%2E177489
    Average 94 stars, based on 1 article reviews
    human egfr / her1 / erbb1 (aa 668-1210) protein - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Sino Biological m02h
    M02h, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m02h/Mouse+Noggin+%2F+NOG+Protein/pmc13130669-74-6-2
    Average 94 stars, based on 1 article reviews
    m02h - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Sino Biological mouse noggin / nog protein
    Mouse Noggin / Nog Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m02h/Mouse+Noggin+%2F+NOG+Protein/custom%4050688-m02h%4041916296
    Average 94 stars, based on 1 article reviews
    mouse noggin / nog protein - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Sino Biological biotinylated mouse cd19 protein
    In standard, ex vivo CAR T cell therapy, T cells are isolated from patient blood and activated using biomaterial systems that present anti-CD3 and anti-CD28. Activated T cells are then transduced with a viral vector to permanently express a CAR. These cells are expanded for 10 to 14 days until a therapeutic dose of CAR T cells is reached before they are reinfused into the patient. In the proposed system of tPNP-mediated in vivo CAR T cell generation, NPs composed of a PBAE polymer, a functional lipid linker, and mRNA encoding a CAR construct are fabricated and combined with anti-CD3 and anti-CD28 antibodies. Upon infusion of tPNPs into a patient, these particles will target, activate, and transfect endogenous T cells to generate functional CAR T cells. In both ex vivo and in vivo systems, the final CAR T cell will then kill its target <t>CD19</t> + B cell.
    Biotinylated Mouse Cd19 Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m02h/Mouse+CD19+Protein/pmc12978253-260-45-49
    Average 94 stars, based on 1 article reviews
    biotinylated mouse cd19 protein - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    In standard, ex vivo CAR T cell therapy, T cells are isolated from patient blood and activated using biomaterial systems that present anti-CD3 and anti-CD28. Activated T cells are then transduced with a viral vector to permanently express a CAR. These cells are expanded for 10 to 14 days until a therapeutic dose of CAR T cells is reached before they are reinfused into the patient. In the proposed system of tPNP-mediated in vivo CAR T cell generation, NPs composed of a PBAE polymer, a functional lipid linker, and mRNA encoding a CAR construct are fabricated and combined with anti-CD3 and anti-CD28 antibodies. Upon infusion of tPNPs into a patient, these particles will target, activate, and transfect endogenous T cells to generate functional CAR T cells. In both ex vivo and in vivo systems, the final CAR T cell will then kill its target CD19 + B cell.

    Journal: Science Advances

    Article Title: Biodegradable targeted polymeric mRNA nanoparticles enable in vivo CD19 CAR T cell generation and lead to B cell depletion

    doi: 10.1126/sciadv.adz1722

    Figure Lengend Snippet: In standard, ex vivo CAR T cell therapy, T cells are isolated from patient blood and activated using biomaterial systems that present anti-CD3 and anti-CD28. Activated T cells are then transduced with a viral vector to permanently express a CAR. These cells are expanded for 10 to 14 days until a therapeutic dose of CAR T cells is reached before they are reinfused into the patient. In the proposed system of tPNP-mediated in vivo CAR T cell generation, NPs composed of a PBAE polymer, a functional lipid linker, and mRNA encoding a CAR construct are fabricated and combined with anti-CD3 and anti-CD28 antibodies. Upon infusion of tPNPs into a patient, these particles will target, activate, and transfect endogenous T cells to generate functional CAR T cells. In both ex vivo and in vivo systems, the final CAR T cell will then kill its target CD19 + B cell.

    Article Snippet: Samples were prepared for flow cytometric analysis of CAR expression via centrifugation at 500 g for 5 min and resuspension in 100 μl of PBS with a 1:1000 dilution of Live Dead-Near IR (Thermo Fisher Scientific, catalog no. L10119 ) and a 1:250 dilution of biotinylated mouse CD19 protein (Sino Biological, catalog no. 50510-M08H-B).

    Techniques: Ex Vivo, Isolation, Transduction, Plasmid Preparation, In Vivo, Polymer, Functional Assay, Construct

    ( A ) Primary murine T cell transfection was evaluated with tPNPs in naïve cells at a dose of 100 ng of mRNA per 50,000 cells ( n = 4). Transfection, as measured by expression of an anti-CD19 CAR construct and the mean fluorescent intensity (MFI) of that CAR expression, is shown. ( B ) CAR expression in primary murine T cells was analyzed over time. T cells were cocultured with tPNPs on day 0, and CAR expression was measured after 1, 2, 3, 4, and 7 days ( n = 3). ( C and D ) T cell activation after 24 hours (h) of coculture with tPNPs was analyzed via CD69 (C) and CD25 (D) expression ( n = 3). ( E ) T cell memory phenotype after 24 hours of coculture with tPNPs was analyzed via CD44 and CD62L expression ( n = 3). Memory subsets were delineated as follows: Naïve: CD44-CD62L + , central memory–like: CD44 + CD62L + , effector memory–like: CD44 + CD62L − . ( F ) T cell proliferation after 72 hours of coculture with tPNPs was measured via CellTrace Violet (CTV) signal. Proliferation is indicated by the number of peaks in CTV signal, with each peak representing a cell division from the original parent population. Proliferation was evaluated relative to a no treatment negative control and a Dynabead positive control, which is a commercially used reagent for T cell stimulation. ( G ) T cell transfection with aCD3+aCD28 PBAE NPs was compared to transfection with aCD3+aCD28 targeted LNPs using the Moderna LNP/SM-102 ionizable lipid formulation at a dose of 100 ng of mRNA per well of a 96-well plate. Statistical analysis for all experiments was performed using a one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test, * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001. ns, not significant.

    Journal: Science Advances

    Article Title: Biodegradable targeted polymeric mRNA nanoparticles enable in vivo CD19 CAR T cell generation and lead to B cell depletion

    doi: 10.1126/sciadv.adz1722

    Figure Lengend Snippet: ( A ) Primary murine T cell transfection was evaluated with tPNPs in naïve cells at a dose of 100 ng of mRNA per 50,000 cells ( n = 4). Transfection, as measured by expression of an anti-CD19 CAR construct and the mean fluorescent intensity (MFI) of that CAR expression, is shown. ( B ) CAR expression in primary murine T cells was analyzed over time. T cells were cocultured with tPNPs on day 0, and CAR expression was measured after 1, 2, 3, 4, and 7 days ( n = 3). ( C and D ) T cell activation after 24 hours (h) of coculture with tPNPs was analyzed via CD69 (C) and CD25 (D) expression ( n = 3). ( E ) T cell memory phenotype after 24 hours of coculture with tPNPs was analyzed via CD44 and CD62L expression ( n = 3). Memory subsets were delineated as follows: Naïve: CD44-CD62L + , central memory–like: CD44 + CD62L + , effector memory–like: CD44 + CD62L − . ( F ) T cell proliferation after 72 hours of coculture with tPNPs was measured via CellTrace Violet (CTV) signal. Proliferation is indicated by the number of peaks in CTV signal, with each peak representing a cell division from the original parent population. Proliferation was evaluated relative to a no treatment negative control and a Dynabead positive control, which is a commercially used reagent for T cell stimulation. ( G ) T cell transfection with aCD3+aCD28 PBAE NPs was compared to transfection with aCD3+aCD28 targeted LNPs using the Moderna LNP/SM-102 ionizable lipid formulation at a dose of 100 ng of mRNA per well of a 96-well plate. Statistical analysis for all experiments was performed using a one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test, * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001. ns, not significant.

    Article Snippet: Samples were prepared for flow cytometric analysis of CAR expression via centrifugation at 500 g for 5 min and resuspension in 100 μl of PBS with a 1:1000 dilution of Live Dead-Near IR (Thermo Fisher Scientific, catalog no. L10119 ) and a 1:250 dilution of biotinylated mouse CD19 protein (Sino Biological, catalog no. 50510-M08H-B).

    Techniques: Transfection, Expressing, Construct, Activation Assay, Negative Control, Positive Control, Cell Stimulation, Formulation

    ( A ) Schematic of in vivo CAR-mediated B cell depletion study. Ten micrograms of tPNPs delivering anti-CD19 CAR-encoding mRNA was administered intravenously to C57BL/6 mice ( n = 5). Mice were bled 12 and 36 hours after NP administration. B cell depletion was measured in blood cells and systemic cytokine secretion was measured in the plasma. Mice were euthanized at the 36-hour time point, and spleens were isolated and processed to measure B cell depletion. ( B to D ) B cell depletion was measured in the blood at 12 hours (B) and 36 hours (C), as well as the spleen at 36 hours (D). Significant CD19 and CD20 B cell killing was elicited by aCD3 and aCD3+aCD28 CAR tPNPs compared to uncoated CAR NPs and control aCD3+aCD28 luciferase mRNA NPs. ( E ) Systemic secretion of cytokines, IFN-γ, TNF-α, IL6, IL-10, CCL3, and granulocyte-macrophage colony-stimulating factor (GM-CSF), was measured in the plasma at 12 and 36 hours. For (B) to (D), individual statistical analysis for depletion of CD19 + or CD20 + cells in each organ was performed using a one-way ANOVA with Tukey’s multiple comparisons test. For (E), individual statistical analysis for secretion of each cytokine at the 12- or 36-hour time point was performed using a one-way ANOVA with Tukey’s multiple comparisons test, * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001.

    Journal: Science Advances

    Article Title: Biodegradable targeted polymeric mRNA nanoparticles enable in vivo CD19 CAR T cell generation and lead to B cell depletion

    doi: 10.1126/sciadv.adz1722

    Figure Lengend Snippet: ( A ) Schematic of in vivo CAR-mediated B cell depletion study. Ten micrograms of tPNPs delivering anti-CD19 CAR-encoding mRNA was administered intravenously to C57BL/6 mice ( n = 5). Mice were bled 12 and 36 hours after NP administration. B cell depletion was measured in blood cells and systemic cytokine secretion was measured in the plasma. Mice were euthanized at the 36-hour time point, and spleens were isolated and processed to measure B cell depletion. ( B to D ) B cell depletion was measured in the blood at 12 hours (B) and 36 hours (C), as well as the spleen at 36 hours (D). Significant CD19 and CD20 B cell killing was elicited by aCD3 and aCD3+aCD28 CAR tPNPs compared to uncoated CAR NPs and control aCD3+aCD28 luciferase mRNA NPs. ( E ) Systemic secretion of cytokines, IFN-γ, TNF-α, IL6, IL-10, CCL3, and granulocyte-macrophage colony-stimulating factor (GM-CSF), was measured in the plasma at 12 and 36 hours. For (B) to (D), individual statistical analysis for depletion of CD19 + or CD20 + cells in each organ was performed using a one-way ANOVA with Tukey’s multiple comparisons test. For (E), individual statistical analysis for secretion of each cytokine at the 12- or 36-hour time point was performed using a one-way ANOVA with Tukey’s multiple comparisons test, * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001.

    Article Snippet: Samples were prepared for flow cytometric analysis of CAR expression via centrifugation at 500 g for 5 min and resuspension in 100 μl of PBS with a 1:1000 dilution of Live Dead-Near IR (Thermo Fisher Scientific, catalog no. L10119 ) and a 1:250 dilution of biotinylated mouse CD19 protein (Sino Biological, catalog no. 50510-M08H-B).

    Techniques: In Vivo, Clinical Proteomics, Isolation, Control, Luciferase

    ( A ) Schematic of in vivo CAR-mediated B cell depletion kinetics study. Ten micrograms of tPNPs delivering anti-CD19 CAR-encoding mRNA was administered intravenously to C57BL/6 mice ( n = 5). Mice were bled on day 0 before tPNP administration to establish a baseline level of B cells in the blood. After aCD3+aCD28 CAR tPNP administration, the mice were bled on days 1, 2, 4, and 7, with B cell depletion being measured in blood cells at each time point. ( B ) B cell depletion was found to be transient, with depletion peaking on day 1 [(B) right] and decreasing over time. ( C ) Schematic of in vivo multiple CAR-tPNP dosing B cell depletion study. Ten micrograms of tPNPs delivering anti-CD19 CAR-encoding mRNA was administered intravenously to C57BL/6 mice ( n = 4) on either days 0 and 1 or on days 0 and 3. Mice blood and spleens were harvested on day 4, and B cell depletion was compared to a baseline PBS-treated control mouse. ( D ) Potent B cell depletion was observed in the peripheral blood and ( E ) the spleen on D4. ( F ) Representative immunohistochemistry (IHC) stains of spleens treated with tPNPs across different dosing regimens. B cells are stained in blue, and T cells are stained in purple. All IHC stains are shown at 2.5× magnification; scale bar, 1 mm, and all samples can be found in fig. S12. For (D) and (E), statistical analysis for depletion of CD19 + B cells in the blood and spleen, respectively, was performed using a one-way ANOVA with Tukey’s multiple comparisons test, * P < 0.05, *** P < 0.001, and **** P < 0.0001.

    Journal: Science Advances

    Article Title: Biodegradable targeted polymeric mRNA nanoparticles enable in vivo CD19 CAR T cell generation and lead to B cell depletion

    doi: 10.1126/sciadv.adz1722

    Figure Lengend Snippet: ( A ) Schematic of in vivo CAR-mediated B cell depletion kinetics study. Ten micrograms of tPNPs delivering anti-CD19 CAR-encoding mRNA was administered intravenously to C57BL/6 mice ( n = 5). Mice were bled on day 0 before tPNP administration to establish a baseline level of B cells in the blood. After aCD3+aCD28 CAR tPNP administration, the mice were bled on days 1, 2, 4, and 7, with B cell depletion being measured in blood cells at each time point. ( B ) B cell depletion was found to be transient, with depletion peaking on day 1 [(B) right] and decreasing over time. ( C ) Schematic of in vivo multiple CAR-tPNP dosing B cell depletion study. Ten micrograms of tPNPs delivering anti-CD19 CAR-encoding mRNA was administered intravenously to C57BL/6 mice ( n = 4) on either days 0 and 1 or on days 0 and 3. Mice blood and spleens were harvested on day 4, and B cell depletion was compared to a baseline PBS-treated control mouse. ( D ) Potent B cell depletion was observed in the peripheral blood and ( E ) the spleen on D4. ( F ) Representative immunohistochemistry (IHC) stains of spleens treated with tPNPs across different dosing regimens. B cells are stained in blue, and T cells are stained in purple. All IHC stains are shown at 2.5× magnification; scale bar, 1 mm, and all samples can be found in fig. S12. For (D) and (E), statistical analysis for depletion of CD19 + B cells in the blood and spleen, respectively, was performed using a one-way ANOVA with Tukey’s multiple comparisons test, * P < 0.05, *** P < 0.001, and **** P < 0.0001.

    Article Snippet: Samples were prepared for flow cytometric analysis of CAR expression via centrifugation at 500 g for 5 min and resuspension in 100 μl of PBS with a 1:1000 dilution of Live Dead-Near IR (Thermo Fisher Scientific, catalog no. L10119 ) and a 1:250 dilution of biotinylated mouse CD19 protein (Sino Biological, catalog no. 50510-M08H-B).

    Techniques: In Vivo, Control, Immunohistochemistry, Staining